ID: 1017602977_1017602982

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1017602977 1017602982
Species Human (GRCh38) Human (GRCh38)
Location 6:156103493-156103515 6:156103516-156103538
Sequence CCACAGGACCCCCTTTAGTCATT CAGAATCACTTTAACTTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 111} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!