ID: 1017622185_1017622189

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1017622185 1017622189
Species Human (GRCh38) Human (GRCh38)
Location 6:156310339-156310361 6:156310365-156310387
Sequence CCACCTCTGCAGTGGCTCTGCTA GCTAACTACAAGAATTACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!