ID: 1017672068_1017672087

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1017672068 1017672087
Species Human (GRCh38) Human (GRCh38)
Location 6:156778042-156778064 6:156778093-156778115
Sequence CCTCCTCCTCCGCGGCGGCAGCG CGGGCTCGGCCATGGAGACGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 10, 3: 33, 4: 375} {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!