ID: 1017673706_1017673720

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1017673706 1017673720
Species Human (GRCh38) Human (GRCh38)
Location 6:156793103-156793125 6:156793148-156793170
Sequence CCAGCACAGCCCTAATATCAGAT GGCATGGCTGGCACCTGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 2, 3: 30, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!