ID: 1017680690_1017680698 |
View in Genome Browser |
Spacer: 26 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1017680690 | 1017680698 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:156861321-156861343 | 6:156861370-156861392 |
Sequence | CCAGGCGTGGTGGTTCATGCCTC | GCCGGTGAATTGCTGGACACAGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 407, 2: 12305, 3: 67251, 4: 158660} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |