ID: 1017680690_1017680698

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1017680690 1017680698
Species Human (GRCh38) Human (GRCh38)
Location 6:156861321-156861343 6:156861370-156861392
Sequence CCAGGCGTGGTGGTTCATGCCTC GCCGGTGAATTGCTGGACACAGG
Strand - +
Off-target summary {0: 3, 1: 407, 2: 12305, 3: 67251, 4: 158660} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!