ID: 1017684135_1017684139

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1017684135 1017684139
Species Human (GRCh38) Human (GRCh38)
Location 6:156895019-156895041 6:156895056-156895078
Sequence CCAGTGGTGTGGTGGTGTTCATG AGAAATCTTGGATGTAAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 140} {0: 1, 1: 0, 2: 2, 3: 20, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!