ID: 1017693872_1017693876

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1017693872 1017693876
Species Human (GRCh38) Human (GRCh38)
Location 6:156994778-156994800 6:156994794-156994816
Sequence CCTCCACCAGTGGACAGACCAGT GACCAGTGGTCTCTGTGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 125} {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!