ID: 1017712195_1017712203

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1017712195 1017712203
Species Human (GRCh38) Human (GRCh38)
Location 6:157180932-157180954 6:157180972-157180994
Sequence CCATGCCCCACCTCCACATGCTG TCCAGCTCCTCCACCACTACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 662} {0: 1, 1: 0, 2: 0, 3: 17, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!