ID: 1017723196_1017723200

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1017723196 1017723200
Species Human (GRCh38) Human (GRCh38)
Location 6:157258713-157258735 6:157258737-157258759
Sequence CCTGGACTGGCTGCTGTGGGTGT GCTGGGTTTTCCCAGCTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 326} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!