ID: 1017731723_1017731731

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1017731723 1017731731
Species Human (GRCh38) Human (GRCh38)
Location 6:157323259-157323281 6:157323288-157323310
Sequence CCTGGGCCGCCAGACTCCGCGGG TCAGGGGCAAGCACAAGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150} {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!