ID: 1017750906_1017750912

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1017750906 1017750912
Species Human (GRCh38) Human (GRCh38)
Location 6:157489809-157489831 6:157489837-157489859
Sequence CCCAGGCTGGAGTGCAGTGGCGT TGGCTCACTGCTATGGGAGTGGG
Strand - +
Off-target summary {0: 20980, 1: 129116, 2: 240855, 3: 208608, 4: 116024} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!