ID: 1017750907_1017750914

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1017750907 1017750914
Species Human (GRCh38) Human (GRCh38)
Location 6:157489810-157489832 6:157489846-157489868
Sequence CCAGGCTGGAGTGCAGTGGCGTG GCTATGGGAGTGGGGAAGATTGG
Strand - +
Off-target summary {0: 22044, 1: 109955, 2: 188319, 3: 217928, 4: 158300} {0: 1, 1: 0, 2: 3, 3: 49, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!