ID: 1017780643_1017780646

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1017780643 1017780646
Species Human (GRCh38) Human (GRCh38)
Location 6:157712931-157712953 6:157712951-157712973
Sequence CCATCGTGATGTCACTTATAGCT GCTCTCCTGGAGATGGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!