ID: 1017783335_1017783342

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1017783335 1017783342
Species Human (GRCh38) Human (GRCh38)
Location 6:157733602-157733624 6:157733630-157733652
Sequence CCCAGCTTCAGCTTACAGGCCTC GGCAGCTAGGACCATGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 208} {0: 1, 1: 1, 2: 1, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!