ID: 1017793875_1017793897

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1017793875 1017793897
Species Human (GRCh38) Human (GRCh38)
Location 6:157823833-157823855 6:157823871-157823893
Sequence CCCGCCGCCCCCACGTCCCCTCC GACCCTCGCCCCCGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 102, 4: 1063} {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!