ID: 1017811990_1017812000

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1017811990 1017812000
Species Human (GRCh38) Human (GRCh38)
Location 6:157990179-157990201 6:157990211-157990233
Sequence CCCCAGGCCCAGGCCGCAGGAGG GTTCCACGGCTCCAGTGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 500} {0: 1, 1: 0, 2: 1, 3: 2, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!