ID: 1017812605_1017812620

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1017812605 1017812620
Species Human (GRCh38) Human (GRCh38)
Location 6:157994873-157994895 6:157994921-157994943
Sequence CCCCAGGGAGTCCCAGGGGGTTC CCTGCACCACCTTGCTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 234} {0: 1, 1: 0, 2: 2, 3: 17, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!