ID: 1017815673_1017815681

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1017815673 1017815681
Species Human (GRCh38) Human (GRCh38)
Location 6:158014850-158014872 6:158014876-158014898
Sequence CCACTCCTGGGGGGCTGAGGGTA AGAGCTTCAGAGGGGAGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 33, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!