ID: 1017821095_1017821100

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1017821095 1017821100
Species Human (GRCh38) Human (GRCh38)
Location 6:158049542-158049564 6:158049593-158049615
Sequence CCTAAAAGAAGCAGCTTAGGGTC TCCAATAATACAACTTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104} {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!