ID: 1017826673_1017826682

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1017826673 1017826682
Species Human (GRCh38) Human (GRCh38)
Location 6:158086838-158086860 6:158086862-158086884
Sequence CCCGCCATGTCCTCCAGATGACG GGACCTGGTGGAGCTCAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 123} {0: 1, 1: 0, 2: 1, 3: 20, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!