ID: 1017858461_1017858464

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1017858461 1017858464
Species Human (GRCh38) Human (GRCh38)
Location 6:158373018-158373040 6:158373056-158373078
Sequence CCAACTTAACACTGCTCAGACAG AAGTAGGTCATGAGTAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109} {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!