ID: 1017860186_1017860188

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1017860186 1017860188
Species Human (GRCh38) Human (GRCh38)
Location 6:158389966-158389988 6:158389979-158390001
Sequence CCGGGTGTGGGTTCAAGTGATTC CAAGTGATTCTCCTGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 229, 4: 1083} {0: 1, 1: 0, 2: 6, 3: 54, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!