ID: 1017882632_1017882646

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1017882632 1017882646
Species Human (GRCh38) Human (GRCh38)
Location 6:158572462-158572484 6:158572507-158572529
Sequence CCCTCTGGTCTGTGGGTCTCCTC GGCCACACCCCTTTTGTCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 244} {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!