ID: 1017885028_1017885031

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1017885028 1017885031
Species Human (GRCh38) Human (GRCh38)
Location 6:158591843-158591865 6:158591874-158591896
Sequence CCTTCCATCTTTTGTATCTATGT AAAGTTGTTCCTGAAGAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 423} {0: 1, 1: 0, 2: 3, 3: 14, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!