ID: 1017903564_1017903570 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1017903564 | 1017903570 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:158739001-158739023 | 6:158739015-158739037 |
| Sequence | CCTTTCCCCTCCCACTCACACAG | CTCACACAGCCCTCCCTGTCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 8, 3: 101, 4: 905} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||