ID: 1017906408_1017906420

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1017906408 1017906420
Species Human (GRCh38) Human (GRCh38)
Location 6:158760028-158760050 6:158760081-158760103
Sequence CCCACCCCACTGGGAGAAGGATG CCCTCTCTTCACTCACTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 170} {0: 1, 1: 0, 2: 3, 3: 24, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!