ID: 1017925545_1017925556

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1017925545 1017925556
Species Human (GRCh38) Human (GRCh38)
Location 6:158909037-158909059 6:158909090-158909112
Sequence CCTGTACTCCCAGCACTTTGGGA GATCGAGACCAGGCCAGGTGTGG
Strand - +
Off-target summary {0: 790, 1: 290306, 2: 263214, 3: 154464, 4: 179276} {0: 1, 1: 0, 2: 8, 3: 25, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!