ID: 1017925553_1017925556

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1017925553 1017925556
Species Human (GRCh38) Human (GRCh38)
Location 6:158909062-158909084 6:158909090-158909112
Sequence CCGAGGTGGGCAGATTGTGAGGT GATCGAGACCAGGCCAGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 25, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!