ID: 1017966594_1017966595

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1017966594 1017966595
Species Human (GRCh38) Human (GRCh38)
Location 6:159272168-159272190 6:159272182-159272204
Sequence CCAGGGATACATACTATGCACAC TATGCACACTCTAGCAACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70} {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!