ID: 1017989115_1017989120 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1017989115 | 1017989120 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:159470927-159470949 | 6:159470962-159470984 |
Sequence | CCTGTGGATGCTCTCCAAGGACT | CTGCAGCTTTTACAGGTGCAAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |