ID: 1018016048_1018016055

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1018016048 1018016055
Species Human (GRCh38) Human (GRCh38)
Location 6:159713297-159713319 6:159713338-159713360
Sequence CCCTGCCTCATCTTTTCAAACCC ATTACACCTCAGCCAGCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 303} {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!