ID: 1018023724_1018023730

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1018023724 1018023730
Species Human (GRCh38) Human (GRCh38)
Location 6:159788520-159788542 6:159788544-159788566
Sequence CCTGTCCCTAAACAAAGCGAGCC ATTTGGCACAGCTTTGATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62} {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!