ID: 1018040288_1018040295

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1018040288 1018040295
Species Human (GRCh38) Human (GRCh38)
Location 6:159915846-159915868 6:159915862-159915884
Sequence CCTCAGAACTGCCCTCCTGGAAG CTGGAAGGGCGAAGGAGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 281} {0: 1, 1: 0, 2: 1, 3: 14, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!