ID: 1018054459_1018054462

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1018054459 1018054462
Species Human (GRCh38) Human (GRCh38)
Location 6:160040022-160040044 6:160040063-160040085
Sequence CCTTGGCGTGCTTCACTGGGAGC TCCACTCTTGTTTTACTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84} {0: 1, 1: 0, 2: 2, 3: 20, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!