ID: 1018057498_1018057502

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1018057498 1018057502
Species Human (GRCh38) Human (GRCh38)
Location 6:160065067-160065089 6:160065080-160065102
Sequence CCGTCACCACCTGGAGCTGCTGT GAGCTGCTGTGGTGACTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 345} {0: 1, 1: 0, 2: 0, 3: 27, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!