ID: 1018057501_1018057508

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1018057501 1018057508
Species Human (GRCh38) Human (GRCh38)
Location 6:160065076-160065098 6:160065110-160065132
Sequence CCTGGAGCTGCTGTGGTGACTGC ATTGGAGCTGAAGCAGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 336} {0: 1, 1: 0, 2: 2, 3: 38, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!