ID: 1018063619_1018063629

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018063619 1018063629
Species Human (GRCh38) Human (GRCh38)
Location 6:160109796-160109818 6:160109828-160109850
Sequence CCTGCCCCACCCAGCGGCTTTAG CTTCAGGAACAATTAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 198} {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!