ID: 1018069198_1018069202

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1018069198 1018069202
Species Human (GRCh38) Human (GRCh38)
Location 6:160146911-160146933 6:160146955-160146977
Sequence CCAAGGGGACTGACTCAAAATGT GTGTAGTTCTCTAGGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 195} {0: 1, 1: 0, 2: 2, 3: 8, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!