ID: 1018072101_1018072109

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018072101 1018072109
Species Human (GRCh38) Human (GRCh38)
Location 6:160173964-160173986 6:160173981-160174003
Sequence CCAGGCTCCCTCTCAACCTCCCT CTCCCTGCTCAGGGAGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 115, 4: 1646} {0: 1, 1: 1, 2: 10, 3: 47, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!