ID: 1018092705_1018092715

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1018092705 1018092715
Species Human (GRCh38) Human (GRCh38)
Location 6:160358816-160358838 6:160358866-160358888
Sequence CCCACACTTCTTTCCAATTGCAG CCCTGGACTTTCCTAAAACCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!