ID: 1018122929_1018122932

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1018122929 1018122932
Species Human (GRCh38) Human (GRCh38)
Location 6:160655224-160655246 6:160655251-160655273
Sequence CCAATAGCTGTCTCTCAAAAGGA AGTTATCTGCAGAAGTGGCAGGG
Strand - +
Off-target summary {0: 3, 1: 195, 2: 220, 3: 170, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!