ID: 1018127817_1018127823

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1018127817 1018127823
Species Human (GRCh38) Human (GRCh38)
Location 6:160698440-160698462 6:160698491-160698513
Sequence CCAGCTTGCATGGACGTGCTTCG TCCACTTCAGGTGAGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 23} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!