ID: 1018130333_1018130334

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018130333 1018130334
Species Human (GRCh38) Human (GRCh38)
Location 6:160724579-160724601 6:160724596-160724618
Sequence CCAGAAGAAGAAAATATATGTTT ATGTTTACACAGAAGAATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 839} {0: 1, 1: 0, 2: 1, 3: 27, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!