ID: 1018196677_1018196685

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1018196677 1018196685
Species Human (GRCh38) Human (GRCh38)
Location 6:161361568-161361590 6:161361594-161361616
Sequence CCCCGTGAAATGGGCAGGGCACA GTGGTATCCCTGACAGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 124} {0: 1, 1: 0, 2: 1, 3: 15, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!