ID: 1018206752_1018206753

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1018206752 1018206753
Species Human (GRCh38) Human (GRCh38)
Location 6:161443739-161443761 6:161443779-161443801
Sequence CCTTTGGTAGAAACAAGTGTGCT TCCTGCCTAAACTGATGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137} {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!