ID: 1018215005_1018215009

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1018215005 1018215009
Species Human (GRCh38) Human (GRCh38)
Location 6:161518240-161518262 6:161518284-161518306
Sequence CCTGCATATCTGCTGGCGCTGAA CCTGCTTTCCAGAAGATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!