ID: 1018221258_1018221262

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1018221258 1018221262
Species Human (GRCh38) Human (GRCh38)
Location 6:161582054-161582076 6:161582088-161582110
Sequence CCAGAGCTCCACGCATGACTGAA GAATCATTGCTTTCATCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82} {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!