ID: 1018229633_1018229636 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1018229633 | 1018229636 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:161663150-161663172 | 6:161663190-161663212 |
| Sequence | CCAGTCACGTGGAACTGTGAGTC | TTTATAAATTACCCAATCTCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 313, 1: 7384, 2: 13951, 3: 14074, 4: 10807} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||