ID: 1018229702_1018229707

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1018229702 1018229707
Species Human (GRCh38) Human (GRCh38)
Location 6:161663822-161663844 6:161663846-161663868
Sequence CCCTGTGGTGAGAGGGTGGCTGG GGACCACGAGGAGCAGCCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!