ID: 1018230813_1018230821

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018230813 1018230821
Species Human (GRCh38) Human (GRCh38)
Location 6:161673491-161673513 6:161673538-161673560
Sequence CCAGGGCACATTGGCCAGGCACC CAAGGGAGCTGAGAAGCCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 39, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!